Top » Catalog » J1 » FGC3747

$18.00

FGC3747
[FGC3747]

FGC3747
hg38 Position: ChrY:15216271..15216271
Ancestral: ins
Derived: del
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC3747_F ACCTGGGAGCAATCTAGGATG
Reverse Primer: FGC3747_R CTATCTAAATCACATGGTAGTGATTATTCATG
Reviews

Customers who bought this product also purchased
FGC74156
FGC74156
FGC74155
FGC74155
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC34532
1 x FGC13889
1 x FGC17476
1 x FGC50846
1 x A17834
1 x FGC45005
1 x FGC4487
1 x FGC4411
1 x FGC7620
1 x ALK248
1 x FGC9585
1 x CTS3041
1 x FGC41257
1 x FGC44923
1 x A22921
1 x A12918
1 x ALK533
$306.00
Haplogroup Info
Other products
Currencies