Top » Catalog » J1 » FGC3747

$18.00

FGC3747
[FGC3747]

FGC3747
hg38 Position: ChrY:15216271..15216271
Ancestral: ins
Derived: del
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC3747_F ACCTGGGAGCAATCTAGGATG
Reverse Primer: FGC3747_R CTATCTAAATCACATGGTAGTGATTATTCATG
Reviews

Customers who bought this product also purchased
FGC74156
FGC74156
FGC74155
FGC74155
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies