Top » Catalog » J1 » A20736

$18.00

A20736
[A20736]

A20736
hg38 Position: ChrY:11895770..11895770
Ancestral: G
Derived: A
Reference: Ahmad Alroqi (2018)
ISOGG Haplogroup: J1
Comments:
Forward Primer: A20736_F TGGGGTCAAGTGGTGTTTTG
Reverse Primer: A20736_R CGCTGGTCATGGACTCAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC5216
1 x A22236
1 x FGC35899
1 x FGC5475
1 x FGC4286
1 x FGC4
1 x ALK205
1 x FGC8710
1 x BY37872
1 x A13647
1 x FGC4357
1 x FGC19205
1 x FGC4348
1 x FGC8733
1 x A24906
1 x A23662
1 x A13640
1 x BY136
1 x A16981
1 x FGC38790
1 x FGC4233
1 x FGC29870
1 x A17373
1 x ALK423
1 x FGC39457
$450.00
Haplogroup Info
Other products
Currencies