Top » Catalog » J1 » A20736

$18.00

A20736
[A20736]

A20736
hg38 Position: ChrY:11895770..11895770
Ancestral: G
Derived: A
Reference: Ahmad Alroqi (2018)
ISOGG Haplogroup: J1
Comments:
Forward Primer: A20736_F TGGGGTCAAGTGGTGTTTTG
Reverse Primer: A20736_R CGCTGGTCATGGACTCAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A13648
$18.00
Haplogroup Info
Other products
Currencies