Top » Catalog » J1 » A20817

$18.00

A20817
[A20817]

A20817
hg38 Position: ChrY:13017696..13017696
Ancestral: G
Derived: C
Reference: Ahmad Alroqi (2018)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: A20817_F TCCAATTCTCAACCGGAGTC
Reverse Primer: A20817_R GCCCAAGAGTTTGAAACCAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies