Top » Catalog » J1 » A20818

$18.00

A20818
[A20818]

A20818
hg38 Position: ChrY:15086883..15086883
Ancestral: G
Derived: C
Reference: Ahmad Alroqi (2018)
ISOGG Haplogroup: J1
Comments:
Forward Primer: A20818_F TTGCAGCCTTTCAATTGTTC
Reverse Primer: A20818_R CAGGCAGACTGCAGAAGATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies