Top » Catalog » J1 » A20819

$18.00

A20819
[A20819]

A20819
hg38 Position: ChrY:15470883..15470883
Ancestral: G
Derived: A
Reference: Ahmad Alroqi (2018)
ISOGG Haplogroup: J1
Comments:
Forward Primer: A20819_F TGCACATGGATTGCATAAGG
Reverse Primer: A20819_R ATGGGGGCCTACCCTACTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x ALK899
1 x BY13778
1 x ALK18
1 x FGC4420
1 x FGC29979
1 x A20821
1 x BY139864
1 x ALK457
1 x ALK536
1 x FGC1608
$180.00
Haplogroup Info
Other products
Currencies