Top » Catalog » J1 » A20820

$18.00

A20820
[A20820]

A20820
hg38 Position: ChrY:18669187..18669187
Ancestral: C
Derived: T
Reference: Ahmad Alroqi (2018)
ISOGG Haplogroup: J1
Comments:
Forward Primer: A20820_F TACAGGGAAGGTCCAGCTTAAAAC
Reverse Primer: A20820_R CTTTTGTTTGAGCCAGTTTTCAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies