Top » Catalog » J1 » A20821

$18.00

A20821
[A20821]

A20821
hg38 Position: ChrY:22359758..22359758
Ancestral: C
Derived: T
Reference: Ahmad Alroqi (2018)
ISOGG Haplogroup: J1
Comments:
Forward Primer: A20821_F CATTTTTTCTGTTTATTGCTTTATTTCTTC
Reverse Primer: A20821_R GGCTGGCAAGCTCCAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies