Top » Catalog » J1 » A20821

$18.00

A20821
[A20821]

A20821
hg38 Position: ChrY:22359758..22359758
Ancestral: C
Derived: T
Reference: Ahmad Alroqi (2018)
ISOGG Haplogroup: J1
Comments:
Forward Primer: A20821_F CATTTTTTCTGTTTATTGCTTTATTTCTTC
Reverse Primer: A20821_R GGCTGGCAAGCTCCAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC4285
1 x FGC42837
1 x FGC4421
1 x A23687
1 x A16979
1 x BY200880
1 x FGC30570
1 x ALK367
1 x BY38105
1 x FGC39468
1 x FGC1703
1 x FGC30701
1 x FGC5224
1 x BY152331
1 x FGC10424
1 x A23886
1 x FGC3722
1 x FGC4480
1 x ALK174
1 x FGC4355
1 x FGC19504
$378.00
Haplogroup Info
Other products
Currencies