Top » Catalog » J1 » A20830

$18.00

A20830
[A20830]

A20830
hg38 Position: ChrY:16655760..16655760
Ancestral: G
Derived: A
Reference: Ahmad Alroqi (2018)
ISOGG Haplogroup: J1
Comments:
Forward Primer: A20830_F GGTCTTGATCTCCTGGCCTC
Reverse Primer: A20830_R CTCTTAAAGTCTGCTTTACTGGTTAGCTATAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies