Top » Catalog » J1 » A20830

$18.00

A20830
[A20830]

A20830
hg38 Position: ChrY:16655760..16655760
Ancestral: G
Derived: A
Reference: Ahmad Alroqi (2018)
ISOGG Haplogroup: J1
Comments:
Forward Primer: A20830_F GGTCTTGATCTCCTGGCCTC
Reverse Primer: A20830_R CTCTTAAAGTCTGCTTTACTGGTTAGCTATAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC16726
1 x FGC50886
1 x FGC19189
1 x ALK875
1 x FGC6782
1 x FGC5240
1 x ALK4
1 x FGC4342
1 x FGC3747
1 x ALK901
1 x FGC10418
1 x FGC5454
1 x ALK391
1 x FGC10423
1 x FGC1709
1 x A17626
1 x A19277
1 x A19263
1 x BY154830
1 x A13649
1 x A20954
1 x BY25901
1 x FGC4288
1 x ALK96
1 x FGC15762
1 x FGC4767
1 x FGC12
$486.00
Haplogroup Info
Other products
Currencies