Top » Catalog » J1 » A20954

$18.00

A20954
[A20954]

A20954
hg38 Position: ChrY:12373245..12373245
Ancestral: C
Derived: A
Reference: YSEQ (2018)
ISOGG Haplogroup: J1
Comments: FGC8705 > FGC8718 > FGC8703 > FGC10500
Forward Primer: A20954_F GCCACCACGCCCAGC
Reverse Primer: A20954_R TACCGGTGTTTAAATGAACACATTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies