Top » Catalog » J1 » A20954

$18.00

A20954
[A20954]

A20954
hg38 Position: ChrY:12373245..12373245
Ancestral: C
Derived: A
Reference: YSEQ (2018)
ISOGG Haplogroup: J1
Comments: FGC8705 > FGC8718 > FGC8703 > FGC10500
Forward Primer: A20954_F GCCACCACGCCCAGC
Reverse Primer: A20954_R TACCGGTGTTTAAATGAACACATTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x DYS388
1 x DYS576
1 x Y-GATA-H4
1 x DYF397
1 x DYS454
1 x DYS497
1 x DYS436
1 x DYS392
1 x DYS570
1 x DYR33
1 x DYS552
1 x DYF401
1 x DYS439
1 x DYS435
1 x DYS710
1 x DYS494
1 x DYS534
1 x DYS575
1 x DYS510
1 x DYS445
1 x DYS389I+II
1 x DYS442
1 x DYS520
1 x DYS635
1 x DYS714
1 x DYS727
1 x DYS438
1 x DYS525
1 x DYS487
1 x DYF406S1
1 x DYS641
1 x DYS444
1 x CDY
1 x DYS481
1 x DYS717
1 x DYS590
1 x DYS643
1 x DYS450
1 x DYS572
1 x DYS532
1 x DXYS156
1 x DYS495
1 x DYS716
1 x DYS462
1 x DYS726
1 x DYS537
1 x DYS455
1 x DYS19
1 x DYF411
1 x DYS446
1 x DYS447
1 x DYF371X
1 x DYS593
1 x DYS426
1 x DYS728
1 x Y-GGAAT-1B07
1 x DYS441
1 x DYS461
1 x DYS626
1 x DYS393
1 x DYS533
1 x DYS464X
1 x DYR112
1 x DYS589
1 x DYS638
$695.15
Haplogroup Info
Other products
Currencies