Top » Catalog » J1 » A20954

$18.00

A20954
[A20954]

A20954
hg38 Position: ChrY:12373245..12373245
Ancestral: C
Derived: A
Reference: YSEQ (2018)
ISOGG Haplogroup: J1
Comments: FGC8705 > FGC8718 > FGC8703 > FGC10500
Forward Primer: A20954v2_F TACAGGCGTGAGCCACG
Reverse Primer: A20954v2_R CATTTTCCTAAAAGAAACGCAGAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC15178
1 x FGC10602
1 x FGC4341
1 x ALK256
1 x FGC1723
1 x A12924
1 x FGC10493
1 x FGC4340
1 x A22923
1 x FGC4298
1 x FGC48130
1 x FGC12861
1 x FGC11743
1 x ALK335
$252.00
Haplogroup Info
Other products
Currencies