Top » Catalog » J1 » ALK2

$19.00

ALK2
[ALK2]

ALK2
hg38 Position: ChrY:7922452..7922452
Ancestral: T
Derived: C
Reference: Ahmad Al-Khuraiji (2017)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: ALK2_F GGTTCAAGCAAAAGGGTTTC
Reverse Primer: ALK2_R AACAGGTAAGTTTATGAGGTGCAAG
Reviews

Customers who bought this product also purchased
ALK1
ALK1
ALK3
ALK3
ALK4
ALK4
ALK5
ALK5
ALK6
ALK6
Wish a SNP
Wish a SNP
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies