Top » Catalog » J1 » ALK2

$18.00

ALK2
[ALK2]

ALK2
hg38 Position: ChrY:7922452..7922452
Ancestral: T
Derived: C
Reference: Ahmad Al-Khuraiji (2017)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: ALK2_F GGTTCAAGCAAAAGGGTTTC
Reverse Primer: ALK2_R AACAGGTAAGTTTATGAGGTGCAAG
Reviews

Customers who bought this product also purchased
ALK5
ALK5
ALK6
ALK6
Wish a SNP
Wish a SNP
ALK1
ALK1
ALK3
ALK3
ALK4
ALK4
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC16726
1 x FGC50886
1 x FGC19189
1 x ALK875
1 x FGC6782
1 x FGC5240
1 x ALK4
1 x FGC4342
1 x FGC3747
1 x ALK901
1 x FGC10418
1 x FGC5454
1 x ALK391
1 x FGC10423
1 x FGC1709
1 x A17626
1 x A19277
1 x A19263
1 x BY154830
1 x A13649
1 x A20954
1 x BY25901
1 x FGC4288
1 x ALK96
$432.00
Haplogroup Info
Other products
Currencies