Top » Catalog » J1 » ALK3

$18.00

ALK3
[ALK3]

ALK3
hg38 Position: ChrY:8165553..8165553
Ancestral: G
Derived: A
Reference: Ahmad Al-Khuraiji (2017)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: ALK3_F CTCATATACCTCACTAAAGTACTCCACATATG
Reverse Primer: ALK3_R CATATAATTTCCAACTTTTTGTATAGAAAGTG
Reviews

Customers who bought this product also purchased
ALK1
ALK1
ALK2
ALK2
ALK4
ALK4
ALK5
ALK5
ALK6
ALK6
Wish a SNP
Wish a SNP
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC38645
1 x FGC4295
1 x FGC11723
1 x FGC16666
1 x FGC5225
1 x ALK358
1 x FGC5241
1 x CTS5551
1 x FGC29872
1 x BY13781
1 x A22922
1 x ALK534
1 x ALK870
1 x FGC50913
1 x FGC4347
1 x A14645
1 x ALK327
$306.00
Haplogroup Info
Other products
Currencies