Top » Catalog » J1 » BY37871

$18.00

BY37871
[BY37871]

BY37871
hg38 Position: ChrY:13155765..13155765
Ancestral: C
Derived: T
Reference: FTDNA (2018)
ISOGG Haplogroup: J1
Comments: Below Z18219
Forward Primer: BY37871_F TGCTTGGTTTAGTGGTAGATTGAG
Reverse Primer: BY37871_R TTGCTTTGGCACTCACTGAC
Reviews

Customers who bought this product also purchased
FGC23317
FGC23317
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A20817
1 x FGC48136
1 x ALK299
1 x ALK141
1 x BY32847
1 x FGC4737
1 x A25008
$126.00
Haplogroup Info
Other products
Currencies