Top » Catalog » J1 » FGC54375

$18.00

FGC54375
[FGC54375]

FGC54375
hg38 Position: ChrY:8943315..8943315
Ancestral: G
Derived: C
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC54375_F TCAAAAAATGTGAAGTGCTGGTAATAC
Reverse Primer: FGC54375_R GGTATGTTATATGCAGCAATATTGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A18932
1 x FGC23319
1 x FGC54377
1 x FGC22262
1 x FGC4422
1 x A16980
$108.00
Haplogroup Info
Other products
Currencies