Top » Catalog » J1 » FGC54376

$18.00

FGC54376
[FGC54376]

FGC54376
hg38 Position: ChrY:9969263..9969263
Ancestral: T
Derived: C
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC54376_F CCTAACTGCGGTAAGAATTGTC
Reverse Primer: FGC54376_R CATGATGGTTTGCACCTACG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies