Top » Catalog » J1 » FGC54378

$18.00

FGC54378
[FGC54378]

FGC54378
hg38 Position: ChrY:15371886..15371886
Ancestral: A
Derived: G
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC54378_F GTGTGTAGAGAAAAATTTGTCAAGCAG
Reverse Primer: FGC54378_R AATTTCAGAATGTGTTATTGGTCTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC20898
1 x BY53567
1 x A13636
$54.00
Haplogroup Info
Other products
Currencies