Top » Catalog » J1 » FGC75587

$18.00

FGC75587
[FGC75587]

FGC75587
hg38 Position: ChrY:19618550..19618550
Ancestral: T
Derived: G
Reference: Full Genomes Corp. (2018)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC75587_F TTGAATGTCCAATCTCGAAGG
Reverse Primer: FGC75587_R CCACACAGGAGGGAAGTGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x ALK213
$18.00
Haplogroup Info
Other products
Currencies