Top » Catalog » J1 » FGC11743

$18.00

FGC11743
[FGC11743]

FGC11743
hg38 Position: ChrY:9286939..9286939
Ancestral: C
Derived: T
Reference: Full Genomes (2014)
ISOGG Haplogroup: J1a
Comments: .
Forward Primer: FGC11743_F ACTTGTTATGCTGCAGGTGC
Reverse Primer: FGC11743_R CCAAATGAAGGGAAAGGTATAGAAG
Reviews

Customers who bought this product also purchased
ZS10722
ZS10722
FGC2
FGC2
FGC7936
FGC7936
FGC11755
FGC11755
FGC1696
FGC1696
FGC6
FGC6
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies