Top » Catalog » J1 » FGC11743

$18.00

FGC11743
[FGC11743]

FGC11743
hg38 Position: ChrY:9286939..9286939
Ancestral: C
Derived: T
Reference: Full Genomes (2014)
ISOGG Haplogroup: J1a
Comments: .
Forward Primer: FGC11743_F ACTTGTTATGCTGCAGGTGC
Reverse Primer: FGC11743_R CCAAATGAAGGGAAAGGTATAGAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies