Top » Catalog » J1 » BY37872

$18.00

BY37872
[BY37872]

BY37872
hg38 Position: ChrY:16283714..16283714
Ancestral: T
Derived: C
Reference: FTDNA (2018)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: BY37872_F GCCTTTCAATTCAATGCCTG
Reverse Primer: BY37872_R GGTTCCCTGGGAAATCAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC10420
$18.00
Haplogroup Info
Other products
Currencies