Top » Catalog » J1 » BY37872

$18.00

BY37872
[BY37872]

BY37872
hg38 Position: ChrY:16283714..16283714
Ancestral: T
Derived: C
Reference: FTDNA (2018)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: BY37872_F GCCTTTCAATTCAATGCCTG
Reverse Primer: BY37872_R GGTTCCCTGGGAAATCAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A19278
1 x A13650
1 x ALK567
1 x FGC31373
1 x FGC4743
1 x FGC34531
1 x BY155375
1 x A14641
1 x A18940
1 x BY256
1 x BY61996
$198.00
Haplogroup Info
Other products
Currencies