Top » Catalog » J1 » A21957

$18.00

A21957
[A21957]

A21957
hg38 Position: ChrY:16579368..16579368
Ancestral: A
Derived: G
Reference: Ahmad Alroqi (2018)
ISOGG Haplogroup: J1
Comments:
Forward Primer: A21957_F TTTGGGAGATCTGCACCTTG
Reverse Primer: A21957_R AATGAGAGCCATGCAAATCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies