Top » Catalog » J1 » A21958

$18.00

A21958
[A21958]

A21958
hg38 Position: ChrY:20017935..20017935
Ancestral: A
Derived: G
Reference: Ahmad Alroqi (2018)
ISOGG Haplogroup: J1
Comments:
Forward Primer: A21958_F TCTCCAGGTTGTCAAAGACTTG
Reverse Primer: A21958_R CCCCTACCAAAAGCATAAAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies