Top » Catalog » J1 » A21959

$18.00

A21959
[A21959]

A21959
hg38 Position: ChrY:7045887..7045887
Ancestral: A
Derived: G
Reference: Ahmad Alroqi (2018)
ISOGG Haplogroup: J1
Comments:
Forward Primer: A21959_F TTGGGGATCATGGAACTCTC
Reverse Primer: A21959_R TGATAGAGCCCCAGGTTTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies