Top » Catalog » J1 » A21959

$18.00

A21959
[A21959]

A21959
hg38 Position: ChrY:7045887..7045887
Ancestral: A
Derived: G
Reference: Ahmad Alroqi (2018)
ISOGG Haplogroup: J1
Comments:
Forward Primer: A21959_F TTGGGGATCATGGAACTCTC
Reverse Primer: A21959_R TGATAGAGCCCCAGGTTTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC23924
1 x A19264
1 x B234
1 x FGC11755
1 x FGC5425
1 x FGC10030
1 x FGC8196
1 x BY259
1 x FGC23318
1 x ALK559
1 x A24503
1 x BY13766
1 x ALK723
1 x FGC5419
1 x FGC22737
1 x FGC28327
1 x CTS426
1 x FGC15173
1 x FGC20877
$342.00
Haplogroup Info
Other products
Currencies