Top » Catalog » J1 » A21960

$18.00

A21960
[A21960]

A21960
hg38 Position: ChrY:7785066..7785066
Ancestral: T
Derived: G
Reference: Ahmad Alroqi (2018)
ISOGG Haplogroup: J1
Comments:
Forward Primer: A21960_F TGGTAAGCATGCTGTCAAAG
Reverse Primer: A21960_R GGTCCCAAGAGATGGAGAGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies