Top » Catalog » J1 » FGC40447

$18.00

FGC40447
[FGC40447]

FGC40447
hg38 Position: ChrY:11863866..11863866
Ancestral: G
Derived: A
Reference: Full Gnomes Corp (2015)
ISOGG Haplogroup: J1
Comments: Downstream FGC8810
Forward Primer: FGC40447_F GCCGTTCTGCACTGATTTCTC
Reverse Primer: FGC40447_R CCAAATGGGCAGAGACCTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC10028
1 x ALK562
1 x FGC20885
$54.00
Haplogroup Info
Other products
Currencies