Top » Catalog » J1 » FGC8797

$18.00

FGC8797
[FGC8797]

FGC8797
hg38 Position: ChrY:7295421..7295421
Ancestral: C
Derived: T
Reference: Full Genomes (2014)
ISOGG Haplogroup: J1
Comments: Downstream FGC8810
Forward Primer: FGC8797_F GAGGTGGGTCAGTGTTATTCAGA
Reverse Primer: FGC8797_R ATCTCACTATTAAGCCTCATTCTAGAGGT
Reviews

Customers who bought this product also purchased
Z18215
Z18215
FGC10591
FGC10591
BY2
BY2
FGC4371
FGC4371
FGC8795
FGC8795
ZS8332
ZS8332
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A20736
$18.00
Haplogroup Info
Other products
Currencies