Top » Catalog » J1 » A22143

$18.00

A22143
[A22143]

A22143
hg38 Position: ChrY:7664351..7664351
Ancestral: T
Derived: G
Reference: Moishe Miller (2018)
ISOGG Haplogroup: J1
Comments: Below ZS2740
Forward Primer: A22143_F GGGAAAGAGCATCAAAACCC
Reverse Primer: A22143_R AGTGGTTTCTTACAGCTCTCTAGAGAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A20736
1 x BY65486
1 x FGC40454
1 x BY10490
1 x BY124800
1 x A14643
1 x FGC19465
$126.00
Haplogroup Info
Other products
Currencies