Top » Catalog » J1 » A22234

$18.00

A22234
[A22234]

A22234
hg38 Position: ChrY:6797375..6797375
Ancestral: G
Derived: T
Reference: Nasser Alanazi (2018)
ISOGG Haplogroup: J1
Comments: Below ZS2010
Forward Primer: A22234_F TACTCTGATCTCAGTTATTTCTCATCTTCC
Reverse Primer: A22234_R GGTGGCTCAATCCTGAATC
Reviews

Customers who bought this product also purchased
A22238
A22238
A22236
A22236
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x S220
1 x FGC22262
$36.00
Haplogroup Info
Other products
Currencies