Top » Catalog » J1 » A22236

$18.00

A22236
[A22236]

A22236
hg38 Position: ChrY:12109128..12109128
Ancestral: C
Derived: A
Reference: Nasser Alanazi (2018)
ISOGG Haplogroup: J1
Comments: Below ZS2010
Forward Primer: A22236_F ATGCTAAAAATGGCGAAACAAC
Reverse Primer: A22236_R AGCACCCCACAGGATGATC
Reviews

Customers who bought this product also purchased
A22234
A22234
A22238
A22238
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC15178
1 x FGC10602
1 x FGC4341
1 x ALK256
1 x FGC1723
1 x A12924
1 x FGC10493
1 x FGC4340
1 x A22923
1 x FGC4298
1 x FGC48130
1 x FGC12861
1 x FGC11743
1 x ALK335
1 x FGC23317
1 x A20953
1 x FGC11759
1 x A22239
1 x BY199962
$342.00
Haplogroup Info
Other products
Currencies