Top » Catalog » J1 » A22236

$18.00

A22236
[A22236]

A22236
hg38 Position: ChrY:12109128..12109128
Ancestral: C
Derived: A
Reference: Nasser Alanazi (2018)
ISOGG Haplogroup: J1
Comments: Below ZS2010
Forward Primer: A22236_F ATGCTAAAAATGGCGAAACAAC
Reverse Primer: A22236_R AGCACCCCACAGGATGATC
Reviews

Customers who bought this product also purchased
A22238
A22238
A22234
A22234
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies