Top » Catalog » J1 » A22239

$18.00

A22239
[A22239]

A22239
hg38 Position: ChrY:17043299..17043299
Ancestral: G
Derived: T
Reference: Nasser Alanazi (2018)
ISOGG Haplogroup: J1
Comments: Below ZS2010
Forward Primer: A22239_F ACAGAAAGTGTGTCATGCACATG
Reverse Primer: A22239_R AATCCCTGAGCTAGACATAAAGGTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies