Top » Catalog » J1 » FGC8710

$18.00

FGC8710
[FGC8710]

FGC8710
hg38 Position: ChrY:13125821..13125821
Ancestral: A
Derived: C
Reference: Full Genomes (2014)
ISOGG Haplogroup: J1
Comments: Below FGC1723 > L859 > FGC8703 > FGC8702
Forward Primer: FGC8710_F GAGGTTGCAGTGAGCCG
Reverse Primer: FGC8710_R TCTATCATGATGAAATCACGCAC
Reviews

Customers who bought this product also purchased
A22247
A22247
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies