Top » Catalog » J1 » FGC8710

$18.00

FGC8710
[FGC8710]

FGC8710
hg38 Position: ChrY:13125821..13125821
Ancestral: A
Derived: C
Reference: Full Genomes (2014)
ISOGG Haplogroup: J1
Comments: Below FGC1723 > L859 > FGC8703 > FGC8702
Forward Primer: FGC8710_F GAGGTTGCAGTGAGCCG
Reverse Primer: FGC8710_R TCTATCATGATGAAATCACGCAC
Reviews

Customers who bought this product also purchased
A22247
A22247
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A22144
1 x A22247
1 x FGC12863
1 x ALK488
1 x FGC7397
1 x BY4
1 x FGC40452
1 x FGC4783
1 x FGC8797
1 x FGC4782
1 x A14687
1 x FGC30610
1 x FGC21142
1 x FGC42459
1 x FGC10420
1 x FGC50952
$288.00
Haplogroup Info
Other products
Currencies