Top » Catalog » J1 » FGC8725

$18.00

FGC8725
[FGC8725]

FGC8725
hg38 Position: ChrY:20609279..20609279
Ancestral: G
Derived: A
Reference: Full Genomes (2014)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC8725_F TCCTGTCAGTCTTTCCTGTGG
Reverse Primer: FGC8725_R CACACAGATGATAAAGAACTAGCATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies