Top » Catalog » J1 » FGC8728

$18.00

FGC8728
[FGC8728]

FGC8728
hg38 Position: ChrY:20836013..20836013
Ancestral: C
Derived: T
Reference: Full Genomes (2014)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC8728_F TGCACTGAGGCTTACTCCTG
Reverse Primer: FGC8728_R TATGGGGTTCCCATTTCTTC
Reviews

Customers who bought this product also purchased
FGC8733
FGC8733
FGC8729
FGC8729
FGC8727
FGC8727
FGC8716
FGC8716
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A19930
1 x A20818
1 x FGC22751
1 x ALK443
$72.00
Haplogroup Info
Other products
Currencies