Top » Catalog » J1 » FGC8709

$18.00

FGC8709
[FGC8709]

FGC8709
hg38 Position: ChrY:12155763..12155763
Ancestral: C
Derived: A
Reference: Full Genomes (2014)
ISOGG Haplogroup: J1
Comments: Below FGC1723 > L859 > FGC8703 > FGC8702
Forward Primer: FGC8709_F TGATTGTGGGTATAGAGGAAGTCTC
Reverse Primer: FGC8709_R TTTTTCCTCCCTTGTGATGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC1731
1 x FGC37830
1 x Y27442
1 x FGC5427
$72.00
Haplogroup Info
Other products
Currencies