Top » Catalog » J1 » FGC8709

$18.00

FGC8709
[FGC8709]

FGC8709
hg38 Position: ChrY:12155763..12155763
Ancestral: C
Derived: A
Reference: Full Genomes (2014)
ISOGG Haplogroup: J1
Comments: Below FGC1723 > L859 > FGC8703 > FGC8702
Forward Primer: FGC8709_F TGATTGTGGGTATAGAGGAAGTCTC
Reverse Primer: FGC8709_R TTTTTCCTCCCTTGTGATGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC5216
1 x A22236
1 x FGC35899
1 x FGC5475
1 x FGC4286
1 x FGC4
1 x ALK205
1 x FGC8710
1 x BY37872
1 x A13647
1 x FGC4357
1 x FGC19205
1 x FGC4348
1 x FGC8733
1 x A24906
1 x A23662
1 x A13640
1 x BY136
1 x A16981
$342.00
Haplogroup Info
Other products
Currencies