Top » Catalog » J1 » BY40604

$18.00

BY40604
[BY40604]

BY40604
hg38 Position: ChrY:2875118..2875118
Ancestral: C
Derived: G
Reference: FTDNA (2018)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: BY40604_F TGCTCAACGTTAAGGCAGTG
Reverse Primer: BY40604_R GGCAAGTATAAAACGGGAAATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC43125
1 x BY3
1 x ALK898
$54.00
Haplogroup Info
Other products
Currencies