Top » Catalog » J1 » CTS8308

$18.00

CTS8308
[CTS8308]

CTS8308
hg38 Position: ChrY:15815794..15815794
Ancestral: G
Derived: A
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: J1 (not listed)
Comments: downstream of FGC11. FGC1723. and L859
Forward Primer: CTS8308_F GACATGGTGGCCTACACCTC
Reverse Primer: CTS8308_R GCCTGCTTCTGCTTACTTTCC
Reviews

Customers who bought this product also purchased
ZS2094
ZS2094
A22247
A22247
FGC9587
FGC9587
ZS4255
ZS4255
L859
L859
ZS10562
ZS10562
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies