Top » Catalog » J1 » FGC10493

$18.00

FGC10493
[FGC10493]

FGC10493
hg38 Position: ChrY:9039035..9039035
Ancestral: G
Derived: A
Reference: Full Genomes (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: downstream of FGC11. FGC1723. and L859
Forward Primer: FGC10493_F CCTGCTTCAACCACCTAAGTG
Reverse Primer: FGC10493_R CAAGAGACAACCAAAACCCC
Reviews

Customers who bought this product also purchased
FGC10492
FGC10492
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x ALK477
1 x FGC48147
1 x BY63983
1 x FGC34537
1 x A15549
1 x CTS4352
1 x FGC42836
1 x FGC37534
1 x ALK1
1 x FGC4742
1 x FGC4279
1 x ALK272
1 x FGC35893
1 x FGC37540
1 x FGC48151
1 x BY8
1 x A13646
1 x A11234
1 x A20820
1 x A19266
1 x BY50885
1 x ALK456
1 x FGC29981
1 x A17831
$432.00
Haplogroup Info
Other products
Currencies