Top » Catalog » J1 » FGC10493

$18.00

FGC10493
[FGC10493]

FGC10493
hg38 Position: ChrY:9039035..9039035
Ancestral: G
Derived: A
Reference: Full Genomes (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: downstream of FGC11. FGC1723. and L859
Forward Primer: FGC10493_F CCTGCTTCAACCACCTAAGTG
Reverse Primer: FGC10493_R CAAGAGACAACCAAAACCCC
Reviews

Customers who bought this product also purchased
FGC10492
FGC10492
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies