Top » Catalog » J1 » FGC4286

$18.00

FGC4286
[FGC4286]

FGC4286
hg38 Position: ChrY:12783105..12783105
Ancestral: C
Derived: G
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1 (not listed)
Comments: .
Forward Primer: FGC4286_F AGCTTCACTTGGTGCTTCAAC
Reverse Primer: FGC4286_R AAGCTGAAATGGGCTGAGAG
Reviews

Customers who bought this product also purchased
DNA Sample Kit
DNA Sample Kit
FGC4284
FGC4284
FGC4298
FGC4298
FGC4278
FGC4278
FGC4295
FGC4295
FGC4293
FGC4293
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x ALK30
1 x FGC29979
$36.00
Haplogroup Info
Other products
Currencies