Top » Catalog » J1 » FGC4293

$18.00

FGC4293
[FGC4293]

FGC4293
hg38 Position: ChrY:16516528..16516528
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1 (not listed)
Comments: .
Forward Primer: FGC4293_F AGCCAGGCATGGGAGG
Reverse Primer: FGC4293_R CCTTCCAAATCAGGGAATAATATG
Reviews

Customers who bought this product also purchased
FGC4278
FGC4278
FGC4295
FGC4295
FGC4289
FGC4289
FGC4288
FGC4288
FGC4286
FGC4286
DNA Sample Kit
DNA Sample Kit
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC75579
$18.00
Haplogroup Info
Other products
Currencies