Top » Catalog » J1 » FGC10409

$18.00

FGC10409
[FGC10409]

FGC10409
hg38 Position: ChrY:7672617..7672617
Ancestral: C
Derived: T
Reference: Full Genomes (2014)
ISOGG Haplogroup: J1 (not listed)
Comments: .
Forward Primer: FGC10409_F ATATTTAAACACGTTATATTTGTCCTTCC
Reverse Primer: FGC10409_R ATGTTTTGGATACTAGAAGTTGAAATTTC
Reviews

Customers who bought this product also purchased
FGC10414
FGC10414
FGC10419
FGC10419
FGC10425
FGC10425
FGC10413
FGC10413
FGC10418
FGC10418
FGC10423
FGC10423
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC42685
1 x FGC20888
1 x BY38100
$54.00
Haplogroup Info
Other products
Currencies